SubtiBank SubtiBank
Version comparison:

2019-05-08 09:43:572025-05-20 16:12:05

locus

BSU04320

BSU_04320

product

high-affinity potassium transporter

high-affinity K+/H+ symporter

outlinks

bsu

BSU04320

BSU_04320

The protein

Catalyzed reaction/ biological activity

uptake of potassium [pubmed|28420751]

K+/H+ symport [pubmed|32005818,28420751]

The protein

Protein family

[SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)

KUP family (single member) [pubmed|32005818]

[SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)

The protein

[SW|Domains]

11 trans-membrane helices at the N-terminus [pubmed|28420751]

12 trans-membrane helices at the N-terminus [pubmed|32005818]

C-terminal cytoplasmic domain [pubmed|28420751]

Biological materials

Mutant

MGNA-C090 (kimA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2088 NBRP B. subtilis, Japan]

1A688 (''[[gene|kimA]]''::''erm''), available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A688&Search=1A688 BGSC]

GP93 ([[gene|kimA]]::''cat''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]

JH642 and its derivatives: natural deletion of the 18 kb [[gene|ydzA]]-[[gene|mntH]] region encompassing the genes [[gene|ydzA]]-[[gene|topB]]-[[gene|ydaJ]]-[[gene|ydaK]]-[[gene|ydaL]]-[[gene|ydaM]]-[[gene|ydaN]]-[[gene|kimA]]-[[gene|mutT]]-[[gene|ydaP]]-[[gene|ydzK]]-[[gene|mntH ]][pubmed|18670626]

BKE04320 ([[gene|kimA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGATGTCTTCCCCTTTT, downstream forward: _UP4_TAAAGCTCTAGGACCAAGGG

BKK04320 ([[gene|kimA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGATGTCTTCCCCTTTT, downstream forward: _UP4_TAAAGCTCTAGGACCAAGGG

GP2720 ([[gene|kimA]]::''spc''), available in [SW|Jörg Stülke]'s lab

GP2721 ([[gene|kimA]]::''ermC''), available in [SW|Jörg Stülke]'s lab

GP2498 ([[gene|kimA]]::''cat'' [[gene|ktrA]]-[[gene|ktrB]]::''spc''), available in [SW|Jörg Stülke]'s lab

MGNA-C090 (kimA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2088 NBRP B. subtilis, Japan]

1A688 (''[[gene|kimA]]''::''erm''), available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A688&Search=1A688 BGSC]

GP93 (Δ[[gene|kimA]]::''cat''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]

JH642 and its derivatives: natural deletion of the 18 kb [[gene|ydzA]]-[[gene|mntH]] region encompassing the genes [[gene|ydzA]]-[[gene|topB]]-[[gene|ydaJ]]-[[gene|ydaK]]-[[gene|ydaL]]-[[gene|ydaM]]-[[gene|ydaN]]-[[gene|kimA]]-[[gene|mutT]]-[[gene|ydaP]]-[[gene|ydzK]]-[[gene|mntH ]][pubmed|18670626]

BKE04320 (Δ[[gene|kimA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGATGTCTTCCCCTTTT, downstream forward: _UP4_TAAAGCTCTAGGACCAAGGG

BKK04320 (Δ[[gene|kimA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGATGTCTTCCCCTTTT, downstream forward: _UP4_TAAAGCTCTAGGACCAAGGG

GP2720 (Δ[[gene|kimA]]::''spc''), available in [SW|Jörg Stülke]'s lab

GP2721 (Δ[[gene|kimA]]::''ermC''), available in [SW|Jörg Stülke]'s lab

GP2498 (Δ[[gene|kimA]]::''cat'' [[gene|ktrA]]-[[gene|ktrB]]::''spc''), available in [SW|Jörg Stülke]'s lab

labs

[SW|Jörg Stülke], Göttingen, Germany

[SW|Jörg Stülke], University of Göttingen, Germany [http://genmibio.uni-goettingen.de Homepage]

[SW|Inga Hänelt], Frankfurt, Germany [https://www.biochem.uni-frankfurt.de/index.php?id=298 Homepage]

References

Reviews

25869574, 28825218

25869574, 28825218, 32472931, 32603625

References

Original publications

15096624, 20511502, 23086297, 24141192, 25086509, 25086507, 28420751, 28679749, 30452022

15096624, 20511502, 23086297, 24141192, 25086509, 25086507, 28420751, 28679749, 30452022, 31061098, 31506295, 32005818, 32253343

The protein

Kinetic information

KM: 215 µM [pubmed|32005818]

Vmax 245 nmol min−1 mg−1 [pubmed|32005818]

The protein

Effectors of protein activity

activity is inhibited upon binding of c-di-AMP [pubmed|31061098]

in the Listeria monocytogenes protein, c-di-AMP binds to the C-terminal cytoplasmic domain of KimA [pubmed|31506295]

The protein

Structure

[PDB|6S3K] [pubmed|32005818]